2.0 (TAKARA, Dalian, China). The entire coding regions of aac(3)-II, aac(6′)-Ib, aac(6′)-II, ant(3″)-I, aph(3′)-VI, armA and rmtB were amplified individually from the positive control isolates with the specific primer listed in Table 3. PCR conditions for the amplifications were as follows: 5 min at 94°C; 30 cycles of 30 s at 94°C, 30 s at 56°C and 1 min at 72°C and a

final extension of 5 min at 72°C. PCR products were cloned using the pMD18-T vector (TAKARA, Dalian, China), into E. coli JM109 and positive clones were selected using an X-Gal/IPTG LB agar plate containing ampicillin (100 mg/L). Recombinant plasmids were buy Vorinostat purified with QIAGEN Plasmid Mini Kit (Qiagen, Hilden, Germany), treated with the RNAse to eliminate residual RNA and subjected to DNA sequencing using T7 and SP6 sequence primers on an AB SOLiDTM 4.0 System (Applied Biosystems, USA). The obtained DNA sequences were compared with relevant sequences in the GenBank database by using the BLAST algorithm (http://​blast.​ncbi.​nlm.​nih.​gov/​Blast.​cgi?​PROGRAM=​blastn&​BLAST_​PROGRAMS=​megaBlast&​PAGE_​TYPE=​BlastSearch&​SHOW_​DEFAULTS=​on&​LINK_​LOC=​blasthome).

Table 3 Primers for the entire coding regions of 7 aminoglycoside-Small molecule library manufacturer resistance genes Primer Sequence (5′→3′) Reference or source Size (bp) aac(3)-II F: ATATCGCGATGCATACGCGG [31] 877 R: GACGGCCTCTAACCGGAAGG aac(6’)-Ib F: TTGCGATGCTCTATGAGTGGCTA [32] 472 R: CTCGAATGCCTGGCGTGTTT aac(6’)-II F: CGACCATTTCATGTCC Janus kinase (JAK) This study* 542 R: GAAGGCTTGTCGTGTTT ant(3″)-I F: CATCATGAGGGAAGCGGTG [33] 787 R: GACTACCTTGGTGATCTCG Ruboxistaurin in vivo aph(3’)-VI F: ATGGAATTGCCCAATATTATT [34] 780 R: TCAATTCAATTCATCAAGTTT armA F: CCGAAATGACAGTTCCTATC [13] 846 R: GAAAATGAGTGCCTTGGAGG rmtB F: ATGAACATCAACGATGCCCTC [13] 769 R: CCTTCTGATTGGCTTATCCA *The primers have been validated with referenced strains (GU944731.1 and HQ880255.1).

Primers In this study, a total of one pair of universal primers (Tag-F/Tag-R) and seven pairs of chimeric primers (specific primers linked to the 3’ end to the universal primers) were designed (Table 4). Tag-F (AGGTGACACTATAGAATA) and Tag-R (GTACGACTCACTATAGGGA) were quasi-T7 sequences and selected by default using the GeXP eXpress Profiler software. The gene-specific sequences of the primers for aac(3)-II, aac(6′)-II, ant(3″)-I were previously reported [15, 20]. The gene-specific sequences of other four pairs of primers were designed by NCBI Primer-Blast and GeXP eXpress Profiler softwares. The primer for aac(6′)-Ib also covered the variant gene aac(6′)-Ib-cr which not only resulted in aminoglycosides resistance but also mediated quinolone resistance [28]. The 5’ ends of the forward and reverse universal primers were labeled with fluorescent dye Cy5 and purified with high pressure liquid chromatography. All chimeric primers were purified by polyacrylamide gel electrophoresis.