5 IG19-35 del R   Reverse

    IG19-10 del F   Forward 8088 58 IG19-35 del R   Reverse     PRIMER EXTENSION ANALYSIS Gene 14 RRG 14-5′rev 5′ gccttctctgctgtcgttgattcc   NA 52 Gene 19 RRG 20-PEXT 5′ cgttaataccactacctgctgggtcg   NA 58 RRG 44 5′ cgcttccgtcccaattttgcttc   NA 58 IN VITRO TRANSCRIPTION ASSAY Gene 14 upstream full-length+lac Z segment RRG 217 5′ attgctcaaccataaaataatggga Forward 882 50 RRG 226 5′ cgccattcgccattag Reverse     RRG 218 5′ gttaataaaccttttataaaag Forward 882 50 RRG 226   Reverse     Gene 19 upstream full-length+lac Z segment RRG 217 5′ attgctcaaccataaaataatggga Forward 601 50 RRG 226   Reverse     RRG 445 5′ atataacctaatagtgacaaataaattaac Forward 601 50 check details RRG 226   Reverse     IN VITRO TRANSCRIPTION COUPLED TRANSLATION ASSAY RRG 185 5′ gactctagacttttaattttattattgccacatg LY3039478 Forward 848 58 RRG 247 5′ tccggctcgtatgttgtgtg

Reverse     * Text in capital letters refers to sequences inserted for creating restriction enzyme sites. ** Primer sequences were presented only once when a primer was described for the first time. Primer extension analysis Primer extension analysis was performed by using a Primer Extension System AMV Reverse Transcriptase kit (Promega, Madison, WI). Briefly, oligonucleotides complementary to the Selleckchem Blasticidin S transcripts of p28-Omp genes 14 and 19 were end labeled with [γ-32p] ATP using T4 polynucleotide kinase (Promega, Madison, WI) at 37°C for 10 min. The kinase reaction was stopped by heat inactivation at 90°C for 2 min. The end labeled primers (one ρ mole each)

were annealed to E. chaffeensis RNA (~10 μg) by incubating at 58°C for 20 min in 11 μl reactions containing AMV primer extension buffer. E. chaffeensis RNA used for this experiment Glutamate dehydrogenase was isolated from cultures when the infection reached to 80–100%. One micro liter of AMV reverse transcriptase (1 unit) was added, and the reaction was incubated at 42°C for 30 min. The reaction products were concentrated by ethanol precipitation and electrophorosed on a 6% polyacrylamide gel containing 7 M urea, and the gel was transferred to a Whatman paper, dried and exposed to an X-ray film. The primer extended products were detected after developing the film with a Konica film processor (Wayne, NJ). Quantitative RT-PCR analysis Quantitative differences in transcripts for p28-Omp genes 14 and 19 were assessed with a TaqMan-based diplex RT-PCR assay using gene-specific primers and probes as we reported earlier [19]. The analysis was performed on total RNA isolated for E.