melanogaster Ago-1, Ago-2, Dcr-1 and Dcr-2 (Table 2). Primers contained a T7 promoter sequence at the 5′ end to allow for transcription {Selleck Anti-infection Compound Library|Selleck Antiinfection Compound Library|Selleck Anti-infection Compound Library|Selleck Antiinfection Compound Library|Selleckchem Anti-infection Compound Library|Selleckchem Antiinfection Compound Library|Selleckchem Anti-infection Compound Library|Selleckchem Antiinfection Compound Library|Anti-infection Compound Library|Antiinfection Compound Library|Anti-infection Compound Library|Antiinfection Compound Library|Anti-infection Compound Library|Antiinfection Compound Library|Anti-infection Compound Library|Antiinfection Compound Library|Anti-infection Compound Library|Antiinfection Compound Library|Anti-infection Compound Library|Antiinfection Compound Library|Anti-infection Compound Library|Antiinfection Compound Library|Anti-infection Compound Library|Antiinfection Compound Library|Anti-infection Compound Library|Antiinfection Compound Library|buy Anti-infection Compound Library|Anti-infection Compound Library ic50|Anti-infection Compound Library price|Anti-infection Compound Library cost|Anti-infection Compound Library solubility dmso|Anti-infection Compound Library purchase|Anti-infection Compound Library manufacturer|Anti-infection Compound Library research buy|Anti-infection Compound Library order|Anti-infection Compound Library mouse|Anti-infection Compound Library chemical structure|Anti-infection Compound Library mw|Anti-infection Compound Library molecular weight|Anti-infection Compound Library datasheet|Anti-infection Compound Library supplier|Anti-infection Compound Library in vitro|Anti-infection Compound Library cell line|Anti-infection Compound Library concentration|Anti-infection Compound Library nmr|Anti-infection Compound Library in vivo|Anti-infection Compound Library clinical trial|Anti-infection Compound Library cell assay|Anti-infection Compound Library screening|Anti-infection Compound Library high throughput|buy Antiinfection Compound Library|Antiinfection Compound Library ic50|Antiinfection Compound Library price|Antiinfection Compound Library cost|Antiinfection Compound Library solubility dmso|Antiinfection Compound Library purchase|Antiinfection Compound Library manufacturer|Antiinfection Compound Library research buy|Antiinfection Compound Library order|Antiinfection Compound Library chemical structure|Antiinfection Compound Library datasheet|Antiinfection Compound Library supplier|Antiinfection Compound Library in vitro|Antiinfection Compound Library cell line|Antiinfection Compound Library concentration|Antiinfection Compound Library clinical trial|Antiinfection Compound Library cell assay|Antiinfection Compound Library screening|Antiinfection Compound Library high throughput|Anti-infection Compound high throughput screening| using MEGAscript® RNAi Kit (Ambion) according to manufacturer’s instruction. Transcription of siRNA

was performed using Silencer® siRNA construction kit (Ambion). 6.0 log10 ± 3.0 log10 S2 cells were plated on six-well plates and incubated for 20 minutes at 28°C. dsRNA/siRNA were diluted in one ml of unconditioned S2 media to 100 nM, applied to the S2 cells, and incubated at 28°C for 16 hrs. Thereafter three ml of conditioned S2 media was added and cells were incubated as described above [31]. Cells were re-fed with dsRNA/siRNA three days following initial treatment. Table 2 Primers used for amplification of targets for dsRNA generation Primer Name Primer sequence1 Protein Dicer-1-Forward CTAATACGACTCACTATAGGGCGGAACACGATTATTTGCCTGGG

Dicer-1 Dicer-1 Reverse CTAATACGACTCACTATAGGGCGCAACACGGTGACAATATCACTG Dicer-1 Dicer-2 Forward CTAATACGACTCACTATAGGGAAGAGCAAGTGCTCACGGTTACAAG Dicer-2 Dicer-2 Reverse CTAATACGACTCACTATAGGGGCGTAGACTGGATGTAGTTGAGCA Dicer-2 Argonaute-2 Forward CTAATACGACTCACTATAGGGCATCAACTATCTGGACCTTGACCTG Argonaute-2 Argonaute-2 Reverse CTAATACGACTCACTATAGGGAAACAACCTCCACGCACTGCATTG Argonaute-2 dsRNAControl-Forward CTAATACGACTCACTATAGGGCAGGTCGTAAATCACTGCATAATTC Control dsRNAControl-Reverse CTAATACGACTCACTATAGGGCACCGTATCTAATATCCAAAACCG Control 1 5′ to 3′ sequence Verification of Knockdown To assess the efficacy of knockdown, Methane monooxygenase seven wells of S2 cells were treated with each of the dsRNA/siRNA’s described above. At two hrs, 24 hrs, and daily thereafter through check details day six post-treatment, cells from one well corresponding to each dsRNA/siRNA treatment were lysed using RIPA buffer (Thermo Scientific, Waltham, MA) and centrifuged for 25 minutes at 10,000 rpm at 4°C. Supernatants were stored at -80°C in order to analyze all samples concurrently. Total protein in each sample was quantified using BCA Protein Assay kit (Pierce, Rockford, IL). Supernatants were separated on a polyacrylamide gel and transferred to Immobilon polyvinylidene

fluoride transfer membranes (Selleck Vorinostat Millipore, Billerica, MA). Membranes were blocked with bovine serum albumin and incubated with D. melanogaster specific anti-Dcr-1 (Catalog number: ab52680), anti-Dcr-2 (Catalog number: ab4732), anti-Ago-1 (Catalog number: ab5070), or anti-Ago-2 antibody (Catalog number: ab5072) (Abcam, Cambridge, MA) as appropriate. Protein bands were visualized with secondary anti-rabbit or anti-mouse HRP-conjugated IgG (Kirkegaard and Perry Laboratories, Gaithersburg, MD) using the ECL system (GE Healthcare). Toxicity assay To assess whether knockdown of Dcr-1, Dcr-2, Ago-1 or Ago-2 affected the viability of S2 cells, a resazurin-based viability assay was performed. S2 cells were propagated to 80% confluency in five 96 well tissue culture treated plates (Costar, Lowell, MA).